Skip to content

CRISPR-edited Knock-in iPS Cells

Accelerate disease model development, drug discovery, and regenerative medicine with the high editing efficiency and precise genomic integration of EditCo's edited iPS Cells.

Let's talk about how our iPS Cells can help your research.
Contact Us
Overview

Unlock advanced CRISPR knock-ins for neuroscience and regenerative medicine research.

  • Quality: Maintain iPSC quality, pluripotency, and cell integrity with EditCo’s editing process.
  • Precision: Focus on the phenotype of your desired edit and minimize off-target effects with transient transfection.
  • Unlocked Capacity: Experience faster lead times with EditCo’s high-throughput automated platform.
iPS Cells

Achieve Precise CRISPR Knock-Ins While Preserving iPSC Quality

Elevate your neuroscience, cardiovascular, or regenerative medicine research with EditCo's precise CRISPR knock-in edits in iPSCs. Let EditCo handle the complex editing process so you can focus on assay development, differentiation, and other downstream applications. Our robust, automated platform ensures high editing efficiencies while maintaining cell quality and pluripotency, providing you with reliable and artifact-free CRISPR-edited iPSCs.

EditCo offers a range of knock-ins, including single nucleotide variants (SNVs), tags, and <100 bp insertions, available in both homozygous and heterozygous states, and in clone or pool formats. Empower your research and accelerate your discoveries with EditCo's advanced CRISPR technology.

EditCo’s Automated iPS Cell Line Editing Process

Cell Pools Clones Timeline

 

Isogenic Neuronal Lines
Isogenic Neuronal Lines: Developing a neuronal isogenic line reverting a disease SNV genotype back to wild type or vice versa is easy with our quality CRISPR edited iPSCs differentiated into your neuronal cell type(s).
Drug Screening
Drug Screening: Enable drug screening in disease-relevant cell types with necessary gene-corrected control lines to increase the rate of success of an identified target compound.
Protein Tagging
Endogenous Tagging of Proteins: Efficiently tag your target protein to study subcellular localization under endogenous regulatory elements.
ICON_disease-modeling
Disease Modeling: Study your mutation of interest in a disease-relevant cell type through edited iPSCs that maintain quality, enabling differentiation.
Single-guide RNA Knock-in Cell Pools

Single-guide RNA Knock-in Cell Pools

High Efficiency CRISPR iPSC Knock-ins with DIY Clonal Isolation

EditCo’s Knock-in iPS Cell Pools provide a heterogeneous mix of CRISPR-edited and unedited cells, giving you high editing efficiency without clonal isolation. Benefit from EditCo’s optimized CRISPR platform, achieving precise edits while allowing you the flexibility to perform clonal isolation yourself. For those seeking a fully automated process, explore our Knock-in iPS Cell Clones for guaranteed homogeneity and convenience.

Features

Cell Source

  • EditCo supplied (standard)
  • Customer supplied

Available Edits

  • SNV, Tag, or Insersion
  • A heterogeneous population of edited and unedited cells

CRISPR Design

  • Synthetic modified sgRNA (standard)
  • Donor ssODN (standard)

Add-ons

  • QC: Pluripotency testing
  • QC: Western blot
  • QC: Whole genome sequencing

Deliverables

  • Regular updates on your order's progress
  • Edited cell pools (2 vials with 5 million cells/vial)
  • Mock-transfected cell pools (2 vials with 5 million cells/vial)
  • Sequence of synthetic sgRNA used
  • Primer sequences used for NGS sequencing
  • NGS sequencing analysis report for each edited pool after expansion.
  • Comprehensive QC report that includes the following information: mycoplasma test (positive/negative), passage number, and analysis for add-on QC

Sequencing deliverable note: For large knock-ins and non-human/mouse cell types an alignment between the Sanger sequencing data of the edited pool and the knock-in sequence will be provided

Robust Editing Across Different iPSC Lines

EditCo’s robust, automated editing platform results in high knock-in efficiency across a range of workhorse iPSC lines and patient derived iPS cell lines, ensuring a high success rate in any iPSC line.

 

iPSC Knock-in

Figure 1. Average knock-in editing efficiency by knock-in type. Knock-in efficiencies were all above 31% and performed in a variety of EditCo-supplied and customer supplied iPSC lines. Tags and Small KIs were all less than 100 bps in length. Knock-in edits were performed using RNPs and ssODNs and editing efficiency was assessed in the pool stage before proceeding to clonal isolation. DNA in each population of cells was PCR-amplified around the cut site, Sanger-sequenced, and submitted for ICE analysis to quantify editing efficiency.

 

EditCo Delivers Pluripotent Edited Cells

Quality comes first in the development of EditCo’s Knock-in iPS Cells by using our automated workflow and transient RNPs to maintain pluripotency of your cells.

iPSC Pluripotency

Figure 3. iPS cells were assessed for standard pluripotency markers, three days post-editing.

Single-guide RNA Knock-in Cell Clones

Single-guide RNA Knock-in Cell Clones

Move Directly Into Your Functional Assays with Confidence

Streamline your research with EditCo’s Knock-in iPS Cell Clones, a homogeneous population of iPSC cells derived from single CRISPR-edited cell. Focus on your functional assays and downstream applications while we handle the entire CRISPR editing and single-cell cloning process, ensuring you receive high-quality, reliable clones to accelerate your scientific breakthroughs.

Features

Cell Source

  • EditCo supplied (standard)
  • Customer supplied

Genetic Modifications

  • SNV, Tag, or Insertion
  • Homozygous or Heterozygous Edits

CRISPR Design

  • Synthetic modified sgRNA (standard)
  • Donor ssODN (Standard)

Add-Ons

  • Additional clones
  • QC: Pluripotency testing
  • QC: Karyotype testing
  • QC: Pluripotency testing
  • QC: Western blot
  • QC: Whole genome sequencing

Deliverables

  • Regular milestone updates on your order's progress
  • 2 independent clones with the required knock-in (2 vials of each clone with 500,000 cells/vial)
  • Mock-transfected cell pools (2 vials with 500,000 cells/vial)
  • Sequence of synthetic sgRNA and HDR template used
  • Primer sequences used for NGS sequencing
  • NGS sequencing analysis report for each edited pool after expansion.
  • Comprehensive QC report that includes the following information: mycoplasma test (positive/negative), passage number, and analysis for add-on QC

Sequencing deliverable note: For large knock-ins and non-human/mouse cell types an alignment between the Sanger sequencing data of the edited pool and the knock-in sequence will be provided

Precise Single Nucleotide Variants (SNVs)

iPSC SNV-2

Figure 3. 100% SNV editing in iPS cell clones. A CRISPR-edited homozygous clone containing a single nucleotide change from cytosine (C, bottom) to thymine (T, top). The SNV change is enclosed by an orange box across both traces. The target sequence (underlined in black) and the PAM site (underlined with a red dashed line) are indicated in the control trace. Human iPS cells were electroporated with sgRNA and Cas9 (as RNPs) along with a ssODN containing the single nucleotide change. To produce clonal populations, single cells were isolated using limiting dilution and expanded.

Cell Lines

Use Our iPS Cell Lines or Onboard Your Own

 
EditCo-supplied cell lines available for all engineered iPS cell orders at no additional cost

* Parental vials available for evaluation prior to booking an edit

**Fully differentiated neurons and glia may be available from one or more of the above lines. Please inquire with BrainXell (www.brainxell.com).

Scientific Publications Featuring EditCo Knock-in iPS Cells

"WTC-11 hiPSCs with integrated blasticidin resistance at the MYH6 locus (WTC-BSD15) were used as the parental line for all hiPSCs in this study. CRISPR Cas9 mediated editing was used to introduce a homozygous knock-in SYNPO2L C>A mutation at chr10:73,655,817 (guide RNA sequence: CGUUACAGGUGUCUAAGGUA) of (gene name) in WTC-BSD15 hiPSCs by EditCo Bio, Inc. (Redwood City, CA, USA)."

  • Pannexin-1 channel activity regulates neurogenesis and cell survival in the developing cortex. Norma K. Hylton, David J. Kang, Steven C. Decker, David Exposito-Alonso, Christie N. Cambridge, Sean R. Golinski, Karla I. Soriano, Jennifer E. Neil, Maya Talukdar, Rebecca E. Andersen, Trenton M. Buckner, Xuyu Qian, Anusha D. Doddi, Stephen R. Braddock, Ellen M. DeGennaro, Shyam K. Akula, Sergi Simo, Richard S. Smith, Christopher A. Walsh bioRxiv 2026.01.09.697058; doi: https://doi.org/10.64898/2026.01.09.697058

  • CRISPR Cas9 mediated knock-in of PANX1 (Thr338Asn) in iPSCs derived from PMG24901 were generated by EditCo Bio, Inc. (Redwood City, CA, USA). To generate these cells, Ribonucleoproteins containing the Cas9 protein and synthetic chemically modified guide RNA produced by Synthego were electroporated into the cells along with a single-stranded oligodeoxynucleotide (ssODN) donor using EditCo's optimized protocol.

Resources

Brochure
EditCo Capabilities Brochure
Discover how EditCo is redefining genome engineering with high-efficiency CRISPR knockouts, knock-ins, and functional tags, built for scalable, reproducible, biologically relevant results.
Download Now
Application Note
CRISPR-Engineered Cells Enable Variant Disease Modeling
Understand how all researchers can leverage CRISPR-engineered cells to model multiple genetic variants and clones at scale.
Learn More
article
A New Research Toolbox at the Forefront of Genomic Engineering
This GEN article describes how EditCo’s novel CRISPR platform is changing cell and gene therapy research, including high-throughput iPSC editing.
Learn More
Flyer
CRISPR-Edited iPS Cells, Guaranteed
CRISPR-Edited iPS Cells, GuaranteedWe offer knockouts, single nucleotide variants, and tag insertions in control or patient-derived iPS cell lines—available in homozygous or heterozygous clone or pool formats.
Learn More
EditCo's Automated CRISPR Platform

Integrating our core CRISPR expertise, high-quality reagents, and automated processes, we deliver the best edited cell-based models at any scale.

CRISPR Engineered Cells Enable Variant Disease Modeling
Icon_Pools_Trans
Leveraging a sophisticated infrastructure with integration between bioinformatics, software, and automated platforms
Learn More
Icon_TCell_Trans
Automating biology and synergistic disciplines for streamlined cell editing and cell culture workflows
Learn More
Icon_iPSC_Trans
Delivering experiment-ready edited cells for your next discoveries through a robust and cohesive ecosystem
Learn More
Lorem Overline

Testimonials consectitur amet sed

Lorem Button Text
Congue fermentum eros leo commodo. Integer vitae vitae ac amet. Vitae sed lectus vel lacus adipiscing nulla facilisis mauris porttitor. Viverra elementum odio vitae id.
placeholder-56x56
Albert Rose, Ph. D.
Principal Investigator, Boston Children's Hospital, Dana-Farber Cancer Institute, Harvard Medical School
Viverra aliquam volutpat interdum quisque vel mattis. Malesuada aliquam egestas pharetra a tempus ullamcorper egestas.
placeholder-56x56
Amanda Peyton, Ph. D.
Principal Investigator, Boston Children's Hospital, Dana-Farber Cancer Institute
Nibh luctus pulvinar sagittis faucibus commodo vitae purus. Ullamcorper dictum.
placeholder-56x56
Joseph James, Ph. D.
Principal Investigator, Boston Children's Hospital
Congue fermentum eros leo commodo. Integer vitae vitae ac amet. Vitae sed lectus vel lacus adipiscing nulla facilisis mauris porttitor. Viverra elementum odio vitae id.
placeholder-56x56
Albert Rose, Ph. D.
Principal Investigator, Boston Children's Hospital, Dana-Farber Cancer Institute, Harvard Medical School
Congue fermentum eros leo commodo. Integer vitae vitae ac amet. Vitae sed lectus vel lacus adipiscing nulla facilisis mauris porttitor. Viverra elementum odio vitae id.
placeholder-56x56
Albert Rose, Ph. D.
Principal Investigator, Boston Children's Hospital, Dana-Farber Cancer Institute, Harvard Medical School
Congue fermentum eros leo commodo. Integer vitae vitae ac amet. Vitae sed lectus vel lacus adipiscing nulla facilisis mauris porttitor. Viverra elementum odio vitae id.
placeholder-56x56
Albert Rose, Ph. D.
Principal Investigator, Boston Children's Hospital, Dana-Farber Cancer Institute, Harvard Medical School
Lorem Button Text

Lectus Pluristyx eu vel leo lectus mi. Viverra cursus neque eget proin.

Pellentesque nec tempus ultrices purus amet adipiscing aliquam. Posuere imperdiet adipiscing non blandit non. Sed eros vel sodales magna sem tincidunt orci risus. Molestie hendrerit cursus faucibus ac neque eget turpis. Arcu leo risus iaculis mi. Tortor bibendum sed cras pretium leo.

0+

Edits Performed

0+

Edits Performed

0+

Edits Performed
Lorem Overline

Lorem Ipsum Dolor Heading

Etiam sollicitudin, ipsum eu pulvinar rutrum, tellus ipsum laoreet sapien, quis venenatis ante odio sit amet eros. Duis arcu tortor, suscipit eget, imperdiet nec, imperdiet iaculis, ipsum. Maecenas nec odio et ante tincidunt tempus. Donec elit libero, sodales nec, volutpat a, suscipit non, turpis. Quisque id mi.

Lorem Button Text
Lorem Overline

Resources aliquam procte

Lorem Button Text
placeholder-280x160
Lorem overline
Ultrices nullam dictumst erat molestie massa a amet pulvinar bibendum lacus.
Tortor consectetur viverra malesuada dignissim duis quis. Morbi purus in velit lacus diam odio sed. Sed nisl arcu amet ut.
Read More
placeholder-280x160
Lorem overline
Ultrices nullam dictumst erat molestie massa a amet pulvinar bibendum lacus.
Tortor consectetur viverra malesuada dignissim duis quis. Morbi purus in velit lacus diam odio sed. Sed nisl arcu amet ut.
Read More
placeholder-280x160
Lorem overline
Ultrices nullam dictumst erat molestie massa a amet pulvinar bibendum lacus.
Tortor consectetur viverra malesuada dignissim duis quis. Morbi purus in velit lacus diam odio sed. Sed nisl arcu amet ut.
Read More
placeholder-280x160
Lorem overline
Ultrices nullam dictumst erat molestie massa a amet pulvinar bibendum lacus.
Tortor consectetur viverra malesuada dignissim duis quis. Morbi purus in velit lacus diam odio sed. Sed nisl arcu amet ut.
Read More
placeholder-280x160
Lorem overline
Ultrices nullam dictumst erat molestie massa a amet pulvinar bibendum lacus.
Tortor consectetur viverra malesuada dignissim duis quis. Morbi purus in velit lacus diam odio sed. Sed nisl arcu amet ut.
Read More
placeholder-280x160
Lorem overline
Ultrices nullam dictumst erat molestie massa a amet pulvinar bibendum lacus.
Tortor consectetur viverra malesuada dignissim duis quis. Morbi purus in velit lacus diam odio sed. Sed nisl arcu amet ut.
Read More
Lorem Button Text

Reach out to our experts to find out what EditCo can do for you